SubtiBank SubtiBank
lutP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lutP

lactate permease
locus
BSU_34190
pI
9.48
mw
59.59 kDa
protein length
563 aa Sequence Blast
gene length
1692 bp Sequence Blast
function
lactate uptake
product
lactate permease
essential
no
synonyms
yvfH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,510,780 → 3,512,471

    Phenotypes of a mutant

  • poor growth with lactate as single carbon source [Pubmed|19201793]
  • The protein

    Catalyzed reaction/ biological activity

  • lactate uptake [Pubmed|19201793]
  • Protein family

  • lactate permease family (with [protein|84D391ED4E81BC17FC2A115985962445D7996DFA|LctP], according to UniProt)
  • Paralogous protein(s)

  • [protein|84D391ED4E81BC17FC2A115985962445D7996DFA|LctP]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25031425], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: repression, in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A489 (yvfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/489 NBRP B. subtilis, Japan]
  • BKE34190 (Δ[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA, downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
  • BKK34190 (Δ[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA, downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

  • 19201793,18763711,16091051,25031425,26582911