SubtiBank SubtiBank
cydB

cydB

cytochrome bd ubiquinol oxidase (subunit II), high affinity terminal oxidase
locus
BSU_38750
pI
9.48
mw
37.70 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
function
respiration
product
cytochrome bd ubiquinol oxidase (subunit II), high affinity terminal oxidase
essential
no
synonyms
yxkL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,976,791 → 3,977,807

    The protein

    Catalyzed reaction/ biological activity

  • 2 ubiquinol + n H+ + O2 --> 2 ubiquinone + n H+ + 2 H2O (according to UniProt)
  • Protein family

  • cytochrome ubiquinol oxidase subunit 2 family (with [protein|813E4BBEC8701114503ACD66DD6FE5A06B6B5E5F|YthB], according to UniProt)
  • [SW|Cofactors]

  • heme b, heme d (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C0459C0D45E31561D281E016D86CD80DCAF13357|cydA]-[gene|E66EAB3C172ED8D1D26C675A7338B8153FB66987|cydB]-[gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]-[gene|244BF9E397FDB0691FFAA8C9D419B0AE417CACE1|cydD]
    description
    [Pubmed|16207915]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [PubMed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|15231791], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|17322317], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|17322317]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B746 (cydB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1745 NBRP B. subtilis, Japan]
  • BKE38750 (Δ[gene|E66EAB3C172ED8D1D26C675A7338B8153FB66987|cydB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCATGAAGAGATGCCATG, downstream forward: _UP4_CATAAGGAGCCTATGACTTA
  • BKK38750 (Δ[gene|E66EAB3C172ED8D1D26C675A7338B8153FB66987|cydB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCATGAAGAGATGCCATG, downstream forward: _UP4_CATAAGGAGCCTATGACTTA
  • References

  • 16207915,17322317,15231791,9852001,10551842,15231791,17322317