SubtiBank SubtiBank
lutR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lutR

transcriptional repressor ([SW|GntR family]) of the [gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|search|lutC ]operon and of [gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]
locus
BSU_34180
pI
4.84
mw
19.50 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast
function
control of lactate utilization
product
transcriptional repressor, ([SW|GntR family])
essential
no
synonyms
yvfI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,509,831 → 3,510,490

    The protein

    Catalyzed reaction/ biological activity

  • transcriptional repressor of the [gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC] operon [Pubmed|19201793]
  • Protein family

  • [SW|GntR family] of transcription factors
  • Effectors of protein activity

  • lactate acts as molecular inducer [Pubmed|19201793]
  • Structure

  • [PDB|6AZ6] ([protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR] from Streptococcus agalactiae, 30% identity) [pubmed|29269393]
  • Expression and Regulation

    Operons

    genes
    [gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25031425], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B607 (yvfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1606 NBRP B. subtilis, Japan]
  • TEK1 lutR::Tn10::spc [Pubmed|24196425]
  • BKE34180 (Δ[gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAATAGGGCATCCG, downstream forward: _UP4_TAACCAACTCATTTCCCGGG
  • BKK34180 (Δ[gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAATAGGGCATCCG, downstream forward: _UP4_TAACCAACTCATTTCCCGGG
  • Expression vectors

  • pQE60-lutR (His-tag) [Pubmed|24196425]
  • lacZ fusion

  • TEK7 lutR::lacZ::erm [Pubmed|24196425]
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • [SW|Ayten Katatas], Istanbul Technical University, Istanbul, Turkey [http://www.bio.itu.edu.tr/personel_data/personel_ayten_yazgan_karatas.htm x]
  • References

  • 24196425,19201793,25031425,18604637,29269393