SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


hydroxamate siderophore [SW|ABC transporter ](ATP-binding protein) (ferrichrome und ferrioxamine)
29.80 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
siderophore uptake
hydroxamate siderophore [SW|ABC transporter ](ATP-binding protein) (ferrichrome und ferrioxamine)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,415,387 → 3,416,196

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + Fe3+-hydroxamate complex-[hydroxamate-binding protein](Side 1) --> ADP + phosphate + Fe3+-hydroxamate complex(Side 2) + [hydroxamate-binding protein] (according to UniProt)
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E76640F895261DA34AD2342B54B43D11857AEA9A|FecF], [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|YusV], [protein|473628F86C18FE9957841F3C8B45242C90CB341D|FpbP]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-240) (according to UniProt)
  • Structure

  • [PDB|4R9U], the ''E. coli'' BtuC-BtuD complex, BtuD shares 34% identity, 55% similarity with FhuC, [Pubmed|25402482]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation




  • [pubmed|22383849]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393,12354229]
  • view in new tab

    Biological materials


  • BKE33290 (Δ[gene|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|fhuC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGGCCCCCTCCTCT, downstream forward: _UP4_TGAAAAAATCCCGGTTTGAA
  • BKK33290 (Δ[gene|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|fhuC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGGCCCCCTCCTCT, downstream forward: _UP4_TGAAAAAATCCCGGTTTGAA
  • References

  • 10092453,16672620,25402482,12354229,29133393