SubtiBank SubtiBank
yslB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yslB

unknown
locus
BSU_28460
pI
4.68
mw
17.14 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,909,030 → 2,909,476

    The protein

    Structure

  • [PDB|3NJC]
  • Expression and Regulation

    Operons

    genes
    [gene|E718DF138154359A22F4D893586A9AC4D36D4C81|yslB]
    description
    [Pubmed|3036830]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: mechanism unknown, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression activated by glucose (5.4 fold) [protein|search|CcpA] [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A991 (yslB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/991 NBRP B. subtilis, Japan]
  • GP516 (spc), available in [SW|Stülke] lab
  • BKE28460 (Δ[gene|E718DF138154359A22F4D893586A9AC4D36D4C81|yslB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTCTCCCCTCTCT, downstream forward: _UP4_TAATCAAAAAGGCGGTGACT
  • BKK28460 (Δ[gene|E718DF138154359A22F4D893586A9AC4D36D4C81|yslB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTCTCCCCTCTCT, downstream forward: _UP4_TAATCAAAAAGGCGGTGACT
  • References

  • 12850135,3036830