SubtiBank SubtiBank
citR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

citR

transcriptional repressor of [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]
locus
BSU_09430
pI
8.67
mw
35.44 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
function
regulation of the minor citrate synthase
product
transcriptional repressor ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,020,073 → 1,020,948

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR]
    description
    [Pubmed|8045898]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • GP1283 Δ(''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR]'')::''aphA3'', available in [SW|Jörg Stülke]'s lab
  • GP1753 Δ(''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR]-[gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]'')::''aphA3'', the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • GP2360 Δ(''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR]-[gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA])''::''erm'', the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • BKE09430 (Δ[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT
  • BKK09430 (Δ[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT
  • Expression vectors

  • pGP2264 (N-terminal His-tag, purification from ''E. coli'', in [SW|pETM-11]), available in [SW|Jörg Stülke]'s lab
  • pGP1023 (C-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP574]), available in [SW|Jörg Stülke]'s lab
  • pGP1029 (N-terminal Strep-tag, purification from ''B. subtilis'', in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pGP1030 (C-terminal Strep-tag, purification from ''B. subtilis'', in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • pGP2260 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP2262 (integration into [gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA], expression under the control of the xylose-inducible PxylA promoter in ''B. subtilis'', in [SW|pGP888]), available in [SW|Jörg Stülke]'s lab
  • References

  • 8045898,8045899