SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional repressor of citA
35.44 kDa
protein length
308 aa Sequence Blast
gene length
924 bp Sequence Blast
regulation of the minor citrate synthase
transcriptional repressor (LysR family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    1,020,073 → 1,020,948

    The protein

    Protein family

  • [SW|LysR family]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • GP1283 (''[gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP1753 (''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR] [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]''::''aphA3''), the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • GP2360 (''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR] [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]''::''erm''), the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • BKE09430 (Δ[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT
  • BKK09430 (Δ[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT
  • Expression vector

  • pGP2264 (N-terminal His-tag, purification from ''E. coli'', in [SW|pETM-11]), available in [SW|Jörg Stülke]'s lab
  • pGP1023 (C-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP574]), available in [SW|Jörg Stülke]'s lab
  • pGP1029 (N-terminal Strep-tag, purification from ''B. subtilis'', in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pGP1030 (C-terminal Strep-tag, purification from ''B. subtilis'', in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • pGP2260 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP2262 (integration into [gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA], expression under the control of the xylose-inducible PxylA promoter in ''B. subtilis'', in [SW|pGP888]), available in [SW|Jörg Stülke]'s lab
  • References

  • 8045898,8045899