SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


3-phosphoserine aminotransferase
39.98 kDa
protein length
359 aa Sequence Blast
gene length
1080 bp Sequence Blast
biosynthesis of serine
3-phosphoserine aminotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • Gene

    1,075,289 → 1,076,368

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + O-phospho-L-serine --> 3-phosphooxypyruvate + L-glutamate (according to UniProt)
  • 2-oxoglutarate + 4-(phosphooxy)-L-threonine --> (R)-3-hydroxy-2-oxo-4-phosphooxybutanoate + L-glutamate (according to UniProt)
  • Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1W23] (from ''Bacillus alcalophilus'', 59% identity) [Pubmed|15608117]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A685 (serC::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A621 ( ''serC''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BKE10020 (Δ[gene|E7ED2FB756B47A0F2C73E42E4168D16F20BD7B1B|serC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATCTCTCCCTGTT, downstream forward: _UP4_TAAAAAGTCTGGCTATGCAA
  • BKK10020 (Δ[gene|E7ED2FB756B47A0F2C73E42E4168D16F20BD7B1B|serC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATCTCTCCCTGTT, downstream forward: _UP4_TAAAAAGTCTGGCTATGCAA
  • References

  • 9579061, 15378759,15608117