SubtiBank SubtiBank
ywrO

ywrO

similar to NAD(P)H oxidoreductase
locus
BSU_35990
pI
5.20
mw
19.81 kDa
protein length
175 aa Sequence Blast
gene length
528 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    Coordinates
    3,708,172 → 3,708,699

    The protein

    Protein family

  • NAD(P)H dehydrogenase (quinone) family (with [protein|2782BD764716CF5FAD0988284310CF75508F2286|YdeQ] and [protein|2EA9792C1C7CD89E43742F57FFB7300725B6AEF4|YrkL], according to UniProt)
  • Paralogous protein(s)

  • [protein|2782BD764716CF5FAD0988284310CF75508F2286|YdeQ], [protein|2EA9792C1C7CD89E43742F57FFB7300725B6AEF4|YrkL]
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|5LVA] (from Streptomyces violaceus, 55% identity) [pubmed|27714222]
  • Expression and Regulation

    Operons

    genes
    [gene|E8048E181756BCE307CF28CF31664421404748A4|ywrO]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B652 (ywrO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1651 NBRP B. subtilis, Japan]
  • BKE35990 (Δ[gene|E8048E181756BCE307CF28CF31664421404748A4|ywrO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGACCACACCTTTACT, downstream forward: _UP4_TAAAATACAGCCCTGTCCAA
  • BKK35990 (Δ[gene|E8048E181756BCE307CF28CF31664421404748A4|ywrO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGACCACACCTTTACT, downstream forward: _UP4_TAAAATACAGCCCTGTCCAA
  • References

  • 9353933,27714222