SubtiBank SubtiBank
ykzQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykzQ

similar to potassium binding protein
locus
BSU_13789
pI
9.00
mw
8.00 kDa
protein length
gene length
228 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,445,314 → 1,445,541

    The protein

    [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] [Pubmed|18430080]
  • [SW|LysM domain] (aa 29-72) (according to UniProt)
  • Structure

  • [PDB|5FIM] (from E. coli, 36% identity) [pubmed|27112601]
  • [SW|Localization]

  • outer spore coat
  • Expression and Regulation

    Operons

    genes
    [gene|FC4C5377EF1D794DCB19D0A8AFE958B84BD9C8BE|ykvP]-[gene|E8311435A86835799E9093DD9CF3733CFFF18DCC|ykzQ]-[gene|BC8CBFF0C2F3C2BEE3275E2CB65D41F2AFC0A1CD|ykvQ]-[gene|4FDAD5E5660EDB346A37C1F41BD8B7B66561E529|ykzR]
    description
    [Pubmed|11011148,22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|11011148,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]) [Pubmed|11011148,15699190]
  • view in new tab

    genes
    [gene|E8311435A86835799E9093DD9CF3733CFFF18DCC|ykzQ]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|26577401], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|26577401], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE13789 (Δ[gene|E8311435A86835799E9093DD9CF3733CFFF18DCC|ykzQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13789 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCCTTCATTCATATTACTC, downstream forward: _UP4_TAATCTTTGAGGTTTCGGAA
  • BKK13789 (Δ[gene|E8311435A86835799E9093DD9CF3733CFFF18DCC|ykzQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13789 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCCTTCATTCATATTACTC, downstream forward: _UP4_TAATCTTTGAGGTTTCGGAA
  • References

  • 18430080,26577401,27766092,27112601