SubtiBank SubtiBank
yfiC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfiC

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_08220
pI
9.62
mw
67.22 kDa
protein length
604 aa Sequence Blast
gene length
1815 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    895,619 → 897,433

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|BmrA], [protein|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|YknU], [protein|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|YknV], [protein|0EB4D3E1B9AF39ECCBD79EB559FAE5BB0EE4C156|YgaD], [protein|D5A3C316BD4567A0155F70330E32ACDE18F063FE|YwjA], [protein|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|BmrC], [protein|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|YfiB]
  • [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • [SW|ABC transmembrane type-1 domain] (aa 49-332) (according to UniProt)
  • [SW|ABC transporter domain] (aa 366-600) (according to UniProt)
  • Structure

  • [PDB|3QF4] ([protein|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|YfiB]-[protein|E85814EDF232D21A42380D559EAD2CDFB41F19DB|YfiC] complex from Thermotoga maritima, 48% identity) [pubmed|22447242]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|yfiB]-[gene|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C293 (yfiC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2291 NBRP B. subtilis, Japan]
  • BKE08220 (Δ[gene|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGGAAAGGCTTGCGGATGT, downstream forward: _UP4_TAGACCTTTGTCCTGCACAG
  • BKK08220 (Δ[gene|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGGAAAGGCTTGCGGATGT, downstream forward: _UP4_TAGACCTTTGTCCTGCACAG
  • References

  • 10092453,22447242