SubtiBank SubtiBank
yabT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabT

Ser/Thr kinase, controls [category|SW 3.3.1|Translation] and DNA integrity during spore development
locus
BSU_00660
pI
9.94
mw
37.51 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
function
control of DNA integrity during spore development
product
Ser/Thr kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    73,809 → 74,825

    Phenotypes of a mutant

  • increased sensitivity to DNA damage during spore development [Pubmed|23634894]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] on Ser-2 [Pubmed|23634894]
  • phosphorylation of [gene|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|EF-Tu] on Thr-63 during [SW|sporulation] [Pubmed|26056311]
  • phosphorylation of [protein|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|YabA] on Thr-71 [pubmed|29619013]
  • ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
  • ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
  • Protein family

  • [SW|protein kinase superfamily] (according to UniProt)
  • [SW|Ser/Thr protein kinase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Protein kinase domain] (aa 28-286) (according to UniProt)
  • Effectors of protein activity

  • autophosphorylation is stimulated by non-specific binding to DNA [Pubmed|23634894]
  • Structure

  • [PDB|6G4J] [pubmed|30671027]
  • [SW|Localization]

  • colocalizes strongly with the septal membrane separating the mother cells from the forespore [Pubmed|23634894]
  • Expression and Regulation

    Operons

    genes
    [gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]-[gene|C8AA53889FC8B389E1D921B762BD78990C7A8E57|yabS]-[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]-[gene|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS]-[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]-[gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B921 (yabT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1920 NBRP B. subtilis, Japan]
  • GP577 (erm), available in [SW|Jörg Stülke]'s lab
  • BKE00660 (Δ[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT, downstream forward: _UP4_TGAATGGTGCAAACTGCAGA
  • BKK00660 (Δ[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT, downstream forward: _UP4_TGAATGGTGCAAACTGCAGA
  • Expression vectors

  • purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP391, available in [SW|Jörg Stülke]'s lab
  • purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP823, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1408, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • translational lacZ fusion (in [SW|pAC7]): pGP831, available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 27148245
  • Original publications

  • 16497325,23634894,24731262,25278935,26056311,29619013,30671027