SubtiBank SubtiBank
yabT
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yabT

Ser/Thr kinase, controls translation and DNA integrity during spore development
locus
BSU00660
pI
9.94
mw
37.51 kDa
protein length
338 aa Sequence Blast
gene length
1014 bp Sequence Blast
function
control of DNA integrity during spore development
product
Ser/Thr kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    73,809 → 74,825

    Phenotypes of a mutant

  • increased sensitivity to DNA damage during spore development [Pubmed|23634894]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] on Ser-2 [Pubmed|23634894]
  • phosphorylation of [gene|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|EF-tu]]] on Thr-63 during [SW|sporulation] [Pubmed|26056311]
  • Protein family

  • [SW|protein kinase] domain (according to Swiss-Prot)
  • Effectors of protein activity

  • autophosphorylation is stimulated by non-specific binding to DNA [Pubmed|23634894]
  • [SW|Localization]

  • colocalizes strongly with the septal membrane separating the mother cells from the forespore [Pubmed|23634894]
  • Expression and Regulation

    Operons

    genes
    [gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]-[gene|C8AA53889FC8B389E1D921B762BD78990C7A8E57|yabS]-[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]-[gene|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS]-[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]-[gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B921 (yabT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1920 NBRP B. subtilis, Japan]
  • GP577 (erm), available in [SW|Jörg Stülke]'s lab
  • BKE00660 (Δ[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT, downstream forward: _UP4_TGAATGGTGCAAACTGCAGA
  • BKK00660 (Δ[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT, downstream forward: _UP4_TGAATGGTGCAAACTGCAGA
  • Expression vector

  • purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP391, available in [SW|Jörg Stülke]'s lab
  • purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP823, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1408, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • translational lacZ fusion (in [protein|search|pAC7]): pGP831, available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 27148245
  • Original publications

  • 16497325,23634894,24731262,25278935,26056311