SubtiBank SubtiBank
ylaN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylaN

unknown
locus
BSU_14840
pI
4.61
mw
10.60 kDa
protein length
gene length
282 bp Sequence Blast
function
unknown
product
unknown
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,552,412 → 1,552,693

    Phenotypes of a mutant

  • essential [Pubmed|12682299], the mutant is viable if iron(III) is added to the medium [Pubmed|27238023]
  • The protein

    Protein family

  • UPF0358 family (single member, according to UniProt)
  • Structure

  • [PDB|2ODM] [Pubmed|17469204]
  • Expression and Regulation

    Operons

    genes
    [gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14840 (Δ[gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTATCCCTCCGTTCC, downstream forward: _UP4_TAAATGATAAAACTCAAACT
  • BKK14840 (Δ[gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTATCCCTCCGTTCC, downstream forward: _UP4_TAAATGATAAAACTCAAACT
  • Expression vectors

  • IPTG inducible expression of Strep-''ylaN'' in ''E. coli'': pGP2579 (in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • IPTG inducible expression of His-''ylaN'' in ''E. coli'': pGP2583 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • References

  • 17005971,17469204,22383849,23420519,27238023,28189581,32949815