SubtiBank SubtiBank
moaB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

moaB

molybdopterin precursor biosynthesis
locus
BSU_29460
pI
5.07
mw
18.31 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
function
nitrate respiration
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    3,014,514 → 3,015,026

    The protein

    Protein family

  • moaB/mog family (single member, according to UniProt)
  • Structure

  • [PDB|1Y5E] (from B. cereus, 61% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E89A93C59339AB8814B92A2DF8C3FF95C5C940D3|moaB]
    description
    [Pubmed|9387221]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A115 (moaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/115 NBRP B. subtilis, Japan]
  • BKE29460 (Δ[gene|E89A93C59339AB8814B92A2DF8C3FF95C5C940D3|moaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGCCCACCTCTTTTAT, downstream forward: _UP4_TAAATGAATAAATACTATGA
  • BKK29460 (Δ[gene|E89A93C59339AB8814B92A2DF8C3FF95C5C940D3|moaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGCCCACCTCTTTTAT, downstream forward: _UP4_TAAATGAATAAATACTATGA
  • References

    Reviews

  • 23539623
  • Original publications

  • 9387221