SubtiBank SubtiBank
lytF [2019-09-05 12:49:28]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lytF [2019-09-05 12:49:28]

gamma-D-glutamate-meso-diaminopimelate muropeptidase, cell separase (major autolysin)
51.23 kDa
protein length
488 aa Sequence Blast
gene length
1467 bp Sequence Blast
cell separation
gamma-D-glutamate-meso-diaminopimelate muropeptidase (major autolysin)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Endopeptidases]
  • Gene

    1,011,792 → 1,013,258

    Phenotypes of a mutant

  • cell separation defect, this is increased by a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation [Pubmed|23855774]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • contains five N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • [SW|LysM domain] 1 (aa 27-70) (according to UniProt)
  • [SW|LysM domain] 2 (aa 92-135) (according to UniProt)
  • [SW|LysM domain] 3 (aa 174-217) (according to UniProt)
  • [SW|LysM domain] 4 (aa 240-283) (according to UniProt)
  • [SW|LysM domain] 5 (aa 307-350) (according to UniProt)
  • Effectors of protein activity

  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4XCM] (from Thermus thermophilus, 31% identity) [pubmed|25760608]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • localizes to cell septa and poles on the vegetative cell surface, this depends on the presence of lipoteichoic acids ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS]) [Pubmed|25288647,22139507]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|10322020], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]: repression, in [regulon|920F91E748EE079FF864011D9052B073567C41E4|SlrR regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • view in new tab

    Biological materials


  • 1A791 ( ''lytF''::''spec''), [Pubmed|10206711], available at [ BGSC]
  • 1A792 ( ''lytF''::''spec''), [Pubmed|1588906], available at [ BGSC]
  • BKE09370 (Δ[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAGCTCTCCTTTTTC, downstream forward: _UP4_TAAAAACAGAAACTGTGCGG
  • BKK09370 (Δ[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAGCTCTCCTTTTTC, downstream forward: _UP4_TAAAAACAGAAACTGTGCGG
  • References


  • 18430080,18266855
  • Original publications

  • 20351052,10322020,10206711,14594841,18761696,19542270,22139507,23855774,23091053,25288647,29458655,29458657,25760608