SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to transcriptional regulator ([SW|MarR family])
18.66 kDa
protein length
164 aa Sequence Blast
gene length
495 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    612,836 → 613,330

    The protein

    Protein family

  • [SW|MarR family]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 28-157) (according to UniProt)
  • Structure

  • [PDB|3BDD] (MarR from Streptococcus suis, corresponds to aa 27 ... 134, 37% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C162 (ydgJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05670 (Δ[gene|E8D1416DB588A4D72E84341F5EAB845E77A84792|ydgJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAATATACAACGATTG, downstream forward: _UP4_GAAGCTTAAGAGGAGTGTAT
  • BKK05670 (Δ[gene|E8D1416DB588A4D72E84341F5EAB845E77A84792|ydgJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAATATACAACGATTG, downstream forward: _UP4_GAAGCTTAAGAGGAGTGTAT