SubtiBank SubtiBank
yjkB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yjkB

similar to amino acid [SW|ABC transporter ](ATP-binding protein)
locus
BSU_12250
pI
5.56
mw
27.67 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
function
unknown
product
[SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,295,748 → 1,296,500

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 13-245) (according to UniProt)
  • Structure

  • [PDB|4YMS] (from Caldanaerobacter subterraneus, 35% identity) [pubmed|25848002]
  • [SW|Localization]

  • associated to the membrane (via [protein|6C432E77C5A6F9955DDF4F7BE3FFD55C30BB812A|YjkA]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|E93AE502A575BFB185A5D782B2F40AD53B27093E|yjkB]-[gene|6C432E77C5A6F9955DDF4F7BE3FFD55C30BB812A|yjkA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A362 (yjkB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/362 NBRP B. subtilis, Japan]
  • BKE12250 (Δ[gene|E93AE502A575BFB185A5D782B2F40AD53B27093E|yjkB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATAATCACCTTTC, downstream forward: _UP4_TTTTTGAAGGGAGGCACTCG
  • BKK12250 (Δ[gene|E93AE502A575BFB185A5D782B2F40AD53B27093E|yjkB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATAATCACCTTTC, downstream forward: _UP4_TTTTTGAAGGGAGGCACTCG
  • References

  • 10092453,25848002