SubtiBank SubtiBank
yqjC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqjC

unknown [SW|sporulation] protein
locus
BSU_23930
pI
5.85
mw
15.54 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,488,329 → 2,488,751

    The protein

    Protein family

  • methylmalonyl-CoA epimerase family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|VOC domain] (aa 3-131) (according to UniProt)
  • Structure

  • [PDB|3OA4] (from B. halodurans, 45% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB]-[gene|E993FA7270DB71B055A36E305D8759BFD4C21ACF|yqjC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [pubmed|26577401], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [pubmed|26577401], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C386 (yqjC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2384 NBRP B. subtilis, Japan]
  • BKE23930 (Δ[gene|E993FA7270DB71B055A36E305D8759BFD4C21ACF|yqjC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCTGCTTTCG, downstream forward: _UP4_CCGAAAGGAGACCAACACAA
  • BKK23930 (Δ[gene|E993FA7270DB71B055A36E305D8759BFD4C21ACF|yqjC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCTGCTTTCG, downstream forward: _UP4_CCGAAAGGAGACCAACACAA
  • References

  • 27766092,26577401