SubtiBank SubtiBank
bmrB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bmrB

regulatory leader peptide for the control of [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression
locus
BSU_09700
pI
11.08
mw
6.18 kDa
protein length
gene length
162 bp Sequence Blast
function
control of [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression
product
leader peptide
essential
no
synonyms
yheJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.9|Other regulators]
  • Gene

    Coordinates
    1,045,037 → 1,045,198

    Expression and Regulation

    Operons

    genes
    [gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]-[gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]
    description
    [Pubmed|25217586]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,25217586], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB]: attenuation, [Pubmed|25217586], in [regulon|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB regulon]
  • regulation

  • ''[protein|search|bmrB]-[protein|search|bmrC]-[protein|search|bmrD]'' expression only occurs during the late-exponential and stationary growth stages ([protein|search|AbrB]) [Pubmed|25217586]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A706 (yheJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/706 NBRP B. subtilis, Japan]
  • BKE09700 (Δ[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCCTTGGCATA, downstream forward: _UP4_TAAGGAAAGACAGGTGTATG
  • BKK09700 (Δ[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCCTTGGCATA, downstream forward: _UP4_TAAGGAAAGACAGGTGTATG
  • References

  • 20817675,25217586