SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


regulatory leader peptide for the control of [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression
6.18 kDa
protein length
gene length
162 bp Sequence Blast
control of [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression
leader peptide

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.9|Other regulators]
  • Gene

    1,045,037 → 1,045,198

    Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,25217586], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB]: attenuation, [Pubmed|25217586], in [regulon|E9956A958C66C4114EB974EA6F9BF30CD951034A|BmrB regulon]
  • regulation

  • ''[protein|search|bmrB]-[protein|search|bmrC]-[protein|search|bmrD]'' expression only occurs during the late-exponential and stationary growth stages ([protein|search|AbrB]) [Pubmed|25217586]
  • view in new tab

    Biological materials


  • MGNA-A706 (yheJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09700 (Δ[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCCTTGGCATA, downstream forward: _UP4_TAAGGAAAGACAGGTGTATG
  • BKK09700 (Δ[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCCTTGGCATA, downstream forward: _UP4_TAAGGAAAGACAGGTGTATG
  • References

  • 20817675,25217586