SubtiBank SubtiBank
cccB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cccB

cytochrome c551, lipoprotein
locus
BSU_35270
pI
5.01
mw
11.79 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
respiration
product
cytochrome c551
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,625,741 → 3,626,079

    The protein

    [SW|Domains]

  • Cytochrome c domain (aa 39-112) (according to UniProt)
  • Structure

  • [PDB|1B7V] (from B. pasteurii, corresponds to aa 43 ... 112, 46% identity) [pubmed|11052663]
  • [SW|Localization]

  • cell membrane, lipoprotein anchored via a diacyl glycerol tail [Pubmed|10473570]
  • Expression and Regulation

    Operons

    genes
    [gene|957053D647F20544AA6CA8B9E1F4CC821F82509D|yvjA]-[gene|E99C4B7C8FB227082FA236B74B62B03DEBE2F0D4|cccB]
    description
    [Pubmed|10473570]
    view in new tab

    Biological materials

    Mutant

  • BKE35270 (Δ[gene|E99C4B7C8FB227082FA236B74B62B03DEBE2F0D4|cccB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAGAAGCACAACTC, downstream forward: _UP4_TAAGATAAAAACATCCTTGC
  • BKK35270 (Δ[gene|E99C4B7C8FB227082FA236B74B62B03DEBE2F0D4|cccB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAGAAGCACAACTC, downstream forward: _UP4_TAAGATAAAAACATCCTTGC
  • References

  • 10473570,11052663