SubtiBank SubtiBank
glpQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glpQ

glycerolphosphate diester phosphodiesterase, degrades wall teichoic acid during phosphate starvation
locus
BSU_02130
pI
9.26
mw
32.81 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
function
glycerol-3-phosphate utilization, degradation of wall teichoic acid during phosphate starvation
product
glycerolphosphate diester phosphodiesterase
essential
no
ec
3.1.4.46
synonyms
ybeD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.3|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.1|Utilization of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    233,014 → 233,895

    The protein

    Catalyzed reaction/ biological activity

  • exohydrolytic activity on wall teichoic acid, acts in concert with [protein|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|PhoD] [Pubmed|27780866]
  • sn-glycero-3-phosphoester + H2O --> alcohol + H+ + sn-glycerol 3-phosphate (according to UniProt)
  • Protein family

  • glycerophosphoryl diester phosphodiesterase family (with [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|YhdW], according to UniProt)
  • Paralogous protein(s)

  • [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|YhdW], [protein|AF37A0E08AAAA9159DD1F0183A61713EF582E830|YqiK]
  • Structure

  • [PDB|5T9B] [Pubmed|27780866]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]-[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]
    description
    [Pubmed|8012593]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8012593], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, via a protein-dependent [SW|RNA switch] [Pubmed|8012593], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10913081], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
  • view in new tab

    genes
    [gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]

    regulation

  • induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
  • view in new tab

    Biological materials

    Mutant

  • BKE02130 (Δ[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCTCCTTATA, downstream forward: _UP4_TAAAAGCAAAAAACCTTGCG
  • BKK02130 (Δ[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCTCCTTATA, downstream forward: _UP4_TAAAAGCAAAAAACCTTGCG
  • References

    Reviews

  • 24373430
  • Original publications

  • 8012593,10913081,18214974,18957862,27780866