SubtiBank SubtiBank
deoR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

deoR

transcriptional repressor of the dra-nupC-pdp operon
locus
BSU_39430
pI
6.00
mw
35.10 kDa
protein length
313 aa Sequence Blast
gene length
942 bp Sequence Blast
function
regulation of deoxyribonucleotide utilization
product
transcriptional repressor
essential
no
synonyms
yxxC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    4,052,379 → 4,053,320

    The protein

    Catalyzed reaction/ biological activity

  • transcription repression of the ''[gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]-[gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]-[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]'' operon
  • Protein family

  • SorC transcriptional regulatory family (with [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR], according to UniProt)
  • [SW|Domains]

  • N-terminal DNA-binding domain [Pubmed|24863636]
  • C-terminal effector binding domain [Pubmed|24863636]
  • Effectors of protein activity

  • deoxyribose-5-phosphate acts as the molecular inducer [Pubmed|24863636]
  • Structure

  • [PDB|4OQQ] (C-terminal effector binding domain) [Pubmed|24863636]
  • [http://pdb.org/pdb/explore/explore.do?structureId=4OQP 4OQP] (C-terminal effector binding domain bound to the effector deoxyribose-5-phosphate ) [Pubmed|24863636]
  • Expression and Regulation

    Operons

    genes
    [gene|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|deoR]
    description
    [Pubmed|10746760]
    view in new tab

    Biological materials

    Mutant

  • BKE39430 (Δ[gene|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|deoR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCACCTCCCTGTGG, downstream forward: _UP4_TGACACGTTCAAACCTTTCA
  • BKK39430 (Δ[gene|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|deoR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCACCTCCCTGTGG, downstream forward: _UP4_TGACACGTTCAAACCTTTCA
  • References

  • 10714997,8550462,10074062,24863636