SubtiBank SubtiBank
ycsA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycsA

putative tartrate dehydrogenase
locus
BSU_04000
pI
5.11
mw
38.67 kDa
protein length
354 aa Sequence Blast
gene length
1065 bp Sequence Blast
function
unknown
product
putative tartrate dehydrogenase
essential
no
ec
1.1.1.93
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    452,830 → 453,894

    The protein

    Catalyzed reaction/ biological activity

  • Tartrate + NAD+ --> oxaloglycolate + NADH (according to UniProt)
  • Protein family

  • Isocitrate and isopropylmalate dehydrogenases family (with [protein|CB7D0E32C044D541CD966DC1F9DA489D518A7703|Icd] and [protein|105E3452D7F142A7D7616E35AF3FB753C9B63E38|LeuB], according to UniProt)
  • Paralogous protein(s)

  • [protein|105E3452D7F142A7D7616E35AF3FB753C9B63E38|LeuB], [protein|CB7D0E32C044D541CD966DC1F9DA489D518A7703|Icd]
  • Structure

  • [PDB|3FMX] (from ''Pseudomonas Putida '', 51% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C020 (ycsA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2018 NBRP B. subtilis, Japan]
  • BKE04000 (Δ[gene|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTTCCCCTGTTAT, downstream forward: _UP4_TGATGAATCAGGCCGGTGGC
  • BKK04000 (Δ[gene|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTTCCCCTGTTAT, downstream forward: _UP4_TGATGAATCAGGCCGGTGGC