SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


RNA-binding regulatory protein, negative effector of asymetric septation at the onset of sporulation
10.75 kDa
protein length
gene length
294 bp Sequence Blast
cell division, control of sporulation initiation
negative effector of asymetric septation

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|Other genes]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.2|RNA chaperones]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    55,866 → 56,159

    The protein

    Protein family

  • SpoVG family (single member, according to UniProt)
  • Modification

  • phosphorylation on (Ser-66 OR Ser-67 OR Thr-68) [Pubmed|17218307]
  • Structure

  • [PDB|2IA9]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|408013], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|2437099], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|16430695]
  • view in new tab

    Biological materials


  • MGNA-A082 (spoVG::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2109 (''[gene|E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775|spoVG]''::''tet'', available in [SW|Jörg Stülke]'s lab)
  • BKE00490 (Δ[gene|E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775|spoVG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTAGTTCACCACCTTT, downstream forward: _UP4_TAAAAAATAACCAAAAAGCA
  • BKK00490 (Δ[gene|E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775|spoVG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTAGTTCACCACCTTT, downstream forward: _UP4_TAAAAAATAACCAAAAAGCA
  • Expression vector

  • pGP2331: in [SW|pBQ200], for expression in B. subtilis, available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • pGP2163: expression of SpoVG-Strep by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP2310: expression of SpoVG-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • References

  • 408013,1850083,16430695,6405278,6411929,10348850,7559352,8419299,3100810,2437099,17218307,20803133,27048798