SubtiBank SubtiBank
comGB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

comGB

polytopic membrane protein , DNA transport machinery
locus
BSU_24720
pI
8.65
mw
36.90 kDa
protein length
323 aa Sequence Blast
gene length
972 bp Sequence Blast
function
genetic competence, DNA uptake
product
DNA transport machinery
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,557,983 → 2,558,954

    The protein

    Protein family

  • GSP F family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane, polar localization [Pubmed|15083159,21278288]
  • Expression and Regulation

    Operons

    genes
    [gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]-[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
    description
    [Pubmed|26735940,2507524]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • BKE24720 (Δ[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACCGAGCCTCTTTA, downstream forward: _UP4_AATCAAATGTGAAAGGAAGA
  • BKK24720 (Δ[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACCGAGCCTCTTTA, downstream forward: _UP4_AATCAAATGTGAAAGGAAGA
  • BP914 (Δ([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG])::phleo), available in [SW|Fabian Commichau]'s lab
  • References

    Reviews

  • 15083159
  • Original publications

  • 9422590,11814663,2507524,12107147,8196543