SubtiBank SubtiBank
mdxF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mdxF

maltodextrin [SW|ABC transporter], permease
locus
BSU_34600
pI
8.78
mw
48.37 kDa
protein length
435 aa Sequence Blast
gene length
1308 bp Sequence Blast
function
maltodextrin utilization
product
maltodextrin [SW|ABC transporter], permease
essential
no
synonyms
yvdH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,553,206 → 3,554,513

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|MalFG subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|75B1FD4AA7612B3B600CB0CE35319A6960536095|GanP]
  • Structure

  • [PDB|2R6G] (from E. coli, C-terminal domain, aa 173-427, 36% identity) [pubmed|18033289]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]-[gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]-[gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]-[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]-[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]-[gene|68C6FD5D4D9491EE15A5015447959A45C36EA702|yvdJ]-[gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]-[gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]-[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]
    description
    [Pubmed|16707683]

    regulation

  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B626 (yvdH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1625 NBRP B. subtilis, Japan]
  • BKE34600 (Δ[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCGCCCTCTATTC, downstream forward: _UP4_TTTGGCAATGAGGAGGTTAT
  • BKK34600 (Δ[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCGCCCTCTATTC, downstream forward: _UP4_TTTGGCAATGAGGAGGTTAT
  • References

  • 10092453,16707683,18033289