SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


two-component sensor kinase
37.12 kDa
protein length
320 aa Sequence Blast
gene length
963 bp Sequence Blast
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    221,950 → 222,912

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|5F6D14A0B360832F9FD470668B006A628B109A56|YbdJ]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • two transmembrane segments
  • [SW|HAMP domain] (aa 67-120) (according to UniProt)
  • [SW|Histidine kinase domain] (aa 135-320) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    [ DBTBS]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: positive regulation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Biological materials


  • MGNA-B957 (ybdK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02010 (Δ[gene|EA36C28A990EFFAEBFE279467A0B56B6B5F5255D|ybdK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGATATTTTGTCTTGA, downstream forward: _UP4_TGACCCCGCTGATGTTTTTC
  • BKK02010 (Δ[gene|EA36C28A990EFFAEBFE279467A0B56B6B5F5255D|ybdK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGATATTTTGTCTTGA, downstream forward: _UP4_TGACCCCGCTGATGTTTTTC
  • References

  • 10094672,11948146,20035725