SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


stress protein
5.36 kDa
protein length
gene length
138 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    844,097 → 844,234

    Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-C340 (yflD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07720 (Δ[gene|EA62F1DF6BB9204BB7A6B0CC6A05F63D711A451F|yflD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATTTTCACTTTTCT, downstream forward: _UP4_GTATAGATAAAAAGAGGTGA
  • BKK07720 (Δ[gene|EA62F1DF6BB9204BB7A6B0CC6A05F63D711A451F|yflD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATTTTCACTTTTCT, downstream forward: _UP4_GTATAGATAAAAAGAGGTGA
  • References

  • 26577401