SubtiBank SubtiBank
ywfA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywfA

similar to chloramphenicol resistance
locus
BSU_37750
pI
9.19
mw
44.39 kDa
protein length
412 aa Sequence Blast
gene length
1239 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-79d

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,874,332 → 3,875,570

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EA9A262EEC24BB159F0A6D207D0D88417B31027D|ywfA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B670 (ywfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1669 NBRP B. subtilis, Japan]
  • BKE37750 (Δ[gene|EA9A262EEC24BB159F0A6D207D0D88417B31027D|ywfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCTCAAACACCTC, downstream forward: _UP4_TAAACAAAGTTTCTAAATTC
  • BKK37750 (Δ[gene|EA9A262EEC24BB159F0A6D207D0D88417B31027D|ywfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCTCAAACACCTC, downstream forward: _UP4_TAAACAAAGTTTCTAAATTC