SubtiBank SubtiBank
zapA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

zapA

positive modulator of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] Z ring assembly and stability
locus
BSU_28610
pI
7.17
mw
9.73 kDa
protein length
gene length
258 bp Sequence Blast
function
control of Z-ring formation
product
Z-ring-associated protein, member of the [SW|divisome]
essential
no
synonyms
yshA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • Gene

    Coordinates
    2,925,640 → 2,925,897

    Phenotypes of a mutant

  • a ''[gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA] [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' double mutant forms filamentous cells [Pubmed|16420366]
  • a ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]'' double mutant grows poorly, and the cells are filamentous (due to a defect in Z ring assembly) [Pubmed|24097947]
  • the defects of the ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]'' double mutant can be suppressed by inactivation of either ''[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]'', ''[gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA]'', or ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' [Pubmed|24097947]
  • The protein

    Protein family

  • ZapA family (single member, according to UniProt)
  • Structure

  • [PDB|1W2E] (from ''Pseudomonas aeruginosa'') [Pubmed|15288790]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]-[gene|93726C423313C653C4F71CB107FA12F686959E41|yshB]-[gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]-[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB]-[gene|18CEF3F1EE2E95A009699DE370CBB44F025B7B40|yshE]
    description
    [Pubmed|22383849]

    regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B027 (yshA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1026 NBRP B. subtilis, Japan]
  • BKE28610 (Δ[gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTTTCTCCTCCATTCC, downstream forward: _UP4_CTTAAAGAAAAGGATTGAAC
  • BKK28610 (Δ[gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTTTCTCCTCCATTCC, downstream forward: _UP4_CTTAAAGAAAAGGATTGAAC
  • References

    Reviews

  • 19680248,19884039,23701187
  • Original Publications

  • 15288790,12368265,16420366,18588879,19429628,19843223,24097947,23098212