SubtiBank SubtiBank
ycbK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycbK

similar to efflux system
locus
BSU_02540
pI
9.57
mw
33.81 kDa
protein length
312 aa Sequence Blast
gene length
939 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    277,342 → 278,280

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • [SW|EamA domain] (aa 173-303) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]-[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]
    description
    [Pubmed|10706627]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10706627], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: transcription termination/ antitermination, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB] [pubmed|10706627], in [regulon|T-box|T-box]
  • regulation

  • ''[protein|search|rtpA]'': induced by tryptophan limitation ([protein|search|T-box] in the mRNA leader) [Pubmed|10706627]
  • view in new tab

    Other regulations

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: translation inhibition,
  • Biological materials

    Mutant

  • MGNA-C033 (ycbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2031 NBRP B. subtilis, Japan]
  • BKE02540 (Δ[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGCTCAGCTTTTCT, downstream forward: _UP4_TAATTTTTATAAAACACACA
  • BKK02540 (Δ[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGCTCAGCTTTTCT, downstream forward: _UP4_TAATTTTTATAAAACACACA
  • References

  • 19258532,10706627,16879415