SubtiBank SubtiBank
ycbK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycbK

similar to efflux system
locus
BSU_02540
pI
9.57
mw
33.81 kDa
protein length
312 aa Sequence Blast
gene length
939 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    277,342 → 278,280

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]-[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]
    description
    [Pubmed|10706627]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10706627], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: transcription termination/ antitermination, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB] [pubmed|10706627], in [regulon|T-box|T-box]
  • regulation

  • ''[protein|search|rtpA]'': induced by tryptophan limitation ([protein|search|T-box] in the mRNA leader) [Pubmed|10706627]
  • view in new tab

    Other regulations

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: translation inhibition,
  • Biological materials

    Mutant

  • MGNA-C033 (ycbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2031 NBRP B. subtilis, Japan]
  • BKE02540 (Δ[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGCTCAGCTTTTCT, downstream forward: _UP4_TAATTTTTATAAAACACACA
  • BKK02540 (Δ[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGCTCAGCTTTTCT, downstream forward: _UP4_TAATTTTTATAAAACACACA
  • References

  • 19258532,10706627,16879415