SubtiBank SubtiBank
yhdF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhdF

similar to glucose 1-dehydrogenase
locus
BSU_09450
pI
5.16
mw
31.36 kDa
protein length
289 aa Sequence Blast
gene length
870 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,022,231 → 1,023,100

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|YxbG], [protein|0FD332269D2D6103E57ACE719E39977C68E38F0A|YvrD], [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|BacC], [protein|248F0805272FED9B38ECBB31E2872BC9EC163CE0|YmfI], [protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|YdaD], [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG], [protein|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|YoxD], [protein|CA4597C6253CCF7D7954686A30AF041808BDF8E5|Gdh], [protein|CE990D33A12C50D22506A52E0099F7D97A762D4E|FadH]
  • [protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|KduD]:
  • [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO]:
  • [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC]:
  • [protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|YhxD]:
  • [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF]:
  • [protein|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|YjdA]:
  • [protein|5964B6E817260DA7937796DDFA753A665A04D650|FabL]:
  • [protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|YxbG] (36.1%), [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|BacC] (37.8%), [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG] (31.6%), [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO] (34.3%), [protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|KduD] (33.1%), [protein|CE990D33A12C50D22506A52E0099F7D97A762D4E|FadH] (31.1%), [protein|248F0805272FED9B38ECBB31E2872BC9EC163CE0|YmfI] (30,6%), [protein|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|YjdA] (33.6%), [protein|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|YoxD] (31.9%), [protein|5964B6E817260DA7937796DDFA753A665A04D650|FabL] (30.1%), [protein|0FD332269D2D6103E57ACE719E39977C68E38F0A|YvrD] (30.2%)
  • Structure

  • [PDB|3I30] (from Bacillus anthracis str. amesAncestor, 66% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]-[gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045898], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|CitR]: repression, [Pubmed|8045899], in [regulon|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|CitR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B478 (yhdF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1477 NBRP B. subtilis, Japan]
  • BKE09450 (Δ[gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCATCACTCCTAGAC, downstream forward: _UP4_TAATCAACGAAAAACCAGCT
  • BKK09450 (Δ[gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCATCACTCCTAGAC, downstream forward: _UP4_TAATCAACGAAAAACCAGCT
  • References

  • 11544224