SubtiBank SubtiBank
rpmH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rpmH

ribosomal protein
locus
BSU_41060
pI
13.00
mw
5.00 kDa
protein length
gene length
135 bp Sequence Blast
function
translation
product
ribosomal protein L34
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    4,215,255 → 4,215,389

    Phenotypes of a mutant

  • severe slow-growth phenotype, suppressed by disruption of ''[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]'' or overexpression of ''[gene|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE]'' [Pubmed|25182490]
  • increased fraction of hyperpolarized cells (35.2% vs. 3.7% in the wild type) [pubmed|30853217]
  • the [SW|ribosome]s are destabilized [pubmed|25182490]
  • The protein

    Catalyzed reaction/ biological activity

  • required for efficient 70S-[SW|ribosome] formation [Pubmed|25182490]
  • Protein family

  • bacterial [SW|ribosomal protein] bL34 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome]
  • Expression and Regulation

    Operons

    genes
    [gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]
    description
    [Pubmed|2987847]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]-[gene|594F2D36BE71A45303A33AA2A2931F56F0A969ED|rnpA]-[gene|D40C202E67A5319A91811DB11356F47A56C97DD2|yidC1]-[gene|23D33E2D7AB1CA02165070DB8238957E3C768E64|jag]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKK41060 (Δ[gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK41060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGACACCTCCCTCG, downstream forward: _UP4_TAGGCCACTGAATAATGTCA
  • References

  • 19653700,2987847,2987848,20525796,23002217,25182490,25903689,30853217