SubtiBank SubtiBank
btr
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

btr

transcriptional activator ([SW|AraC family]), (AraC family DNA-binding domain fused to [protein|516B13F337FD346B4A4A268E35D1EBABB05957E1|FeuA]-like substrate-binding domain), regulation of the [gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]-[gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]-[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]-[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA] operon
locus
BSU_01640
pI
6.43
mw
60.59 kDa
protein length
529 aa Sequence Blast
gene length
1590 bp Sequence Blast
function
regulation of iron acquisition
product
transcription activator ([SW|AraC family])
essential
no
synonyms
ybbB,yzbC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    183,414 → 185,003

    The protein

    Catalyzed reaction/ biological activity

  • binding of a direct repeat in the [gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA] promoter region and transcription activation of the [gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]-[gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]-[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]-[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA] operon in the presence of bacillibactin or enterobactin [Pubmed|17725565,22210890]
  • Protein family

  • [SW|AraC family]
  • [SW|Domains]

  • [SW|Fe/B12 periplasmic-binding domain] (aa 268-528) (according to UniProt)
  • [SW|Cofactors]

  • enterobactin, bacillibactin (co-activators) [Pubmed|17725565]
  • Effectors of protein activity

  • enterobactin, bacillibactin (co-activators) [Pubmed|17725565]
  • Expression and Regulation

    Operons

    genes
    [gene|EB28A65CECE994DF2DF486DEACF40F2533703DB0|btr]
    description
    [Pubmed|12354229]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • expressed under conditions of iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B949 (ybbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1948 NBRP B. subtilis, Japan]
  • BKE01640 (Δ[gene|EB28A65CECE994DF2DF486DEACF40F2533703DB0|btr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGTAGACCACCTTTTC, downstream forward: _UP4_TGATAAATCAGGAATTTGTC
  • BKK01640 (Δ[gene|EB28A65CECE994DF2DF486DEACF40F2533703DB0|btr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGTAGACCACCTTTTC, downstream forward: _UP4_TGATAAATCAGGAATTTGTC
  • References

  • 12884008,17725565,22210890,12354229,23199363,23504016