SubtiBank SubtiBank
gmuE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gmuE

mannose kinase
locus
BSU_05860
pI
5.01
mw
32.29 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
function
glucomannan utilization
product
mannose kinase
essential
no
ec
2.7.1.4
synonyms
ydhR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.25|Utilization of glucomannan]
  • Gene

    Coordinates
    630,912 → 631,811

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-fructose --> ADP + D-fructose 6-phosphate + H+ (according to UniProt)
  • Protein family

  • ROK (NagC/XylR) family (with [protein|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|GlcK] and [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR], according to UniProt)
  • Structure

  • [PDB|1XC3] [Pubmed|21185308]
  • Expression and Regulation

    Operons

    genes
    [gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
    description
    [Pubmed|18177310]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C193 (ydhR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2191 NBRP B. subtilis, Japan]
  • BKE05860 (Δ[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATGGCCTCCTTGT, downstream forward: _UP4_GCAGCATCCGGGGAGGTGCG
  • BKK05860 (Δ[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATGGCCTCCTTGT, downstream forward: _UP4_GCAGCATCCGGGGAGGTGCG
  • References

  • 18177310,10627040,20817675,21185308