SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


mannose kinase
32.29 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
glucomannan utilization
mannose kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucomannan]
  • Gene

    630,912 → 631,811

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-fructose --> ADP + D-fructose 6-phosphate + H+ (according to UniProt)
  • Protein family

  • ROK (NagC/XylR) family (with [protein|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|GlcK] and [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR], according to UniProt)
  • Structure

  • [PDB|1XC3] [Pubmed|21185308]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials


  • MGNA-C193 (ydhR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05860 (Δ[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATGGCCTCCTTGT, downstream forward: _UP4_GCAGCATCCGGGGAGGTGCG
  • BKK05860 (Δ[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGATGGCCTCCTTGT, downstream forward: _UP4_GCAGCATCCGGGGAGGTGCG
  • References

  • 18177310,10627040,20817675,21185308