SubtiBank SubtiBank
yoaU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaU

similar to transcriptional regulator ([SW|LysR family])
locus
BSU_18760
pI
6.56
mw
32.43 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,044,956 → 2,045,828

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • Structure

  • [PDB|5Y2V] (from Synechocystis sp., 22% identity) [pubmed|29279392]
  • Biological materials

    Mutant

  • MGNA-A846 (yoaU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/846 NBRP B. subtilis, Japan]
  • BKE18760 (Δ[gene|EBAC06AE1C91A51BD9F88386BA9633C4B51D073F|yoaU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTATACCCCCAAT, downstream forward: _UP4_TGAATCAGTTATCGTGTTGC
  • BKK18760 (Δ[gene|EBAC06AE1C91A51BD9F88386BA9633C4B51D073F|yoaU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTATACCCCCAAT, downstream forward: _UP4_TGAATCAGTTATCGTGTTGC
  • References

    Research papers

  • 29279392