SubtiBank SubtiBank
yetF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yetF

unknown
locus
BSU_07140
pI
7.09
mw
26.16 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    784,381 → 785,076

    The protein

    Protein family

  • [SW|UPF0702 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B37938C639FC87DAA72AA82998DA8DF25E63CF37|YdfS]
  • Structure

  • [PDB|3C6F]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|18B09A645AC8E13A1AD3B73A0C828E5A0F5D42BB|lplD]-[gene|EBD0F966FD7B3662814D530064BD307561A5CB15|yetF]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26577401], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B457 (yetF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1456 NBRP B. subtilis, Japan]
  • BKE07140 (Δ[gene|EBD0F966FD7B3662814D530064BD307561A5CB15|yetF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATAGCACCTACTT, downstream forward: _UP4_TGACTCTTAGAAAAAAGCTT
  • BKK07140 (Δ[gene|EBD0F966FD7B3662814D530064BD307561A5CB15|yetF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATAGCACCTACTT, downstream forward: _UP4_TGACTCTTAGAAAAAAGCTT
  • References

  • 26577401