SubtiBank SubtiBank
yaaT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yaaT

subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex, required for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] dependent maturation of polycistronic mRNAs, control of the [SW|phosphorelay], required for the achieving a sufficient level of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P for [SW|sporulation] initiation
locus
BSU_00320
pI
4.84
mw
31.07 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
function
control of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] activity, see [SW|Targets of the Y complex]
product
subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex
essential
no
synonyms
ricT

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.5|Effectors of RNA degradation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.6|Other protein controlling the activity of the phosphorelay]
  • Gene

    Coordinates
    41,657 → 42,484

    Phenotypes of a mutant

  • block of [SW|sporulation] at stage 0 [Pubmed|12270811]
  • strongly reduced [SW|genetic competence], strongly reduced [SW|sporulation] [Pubmed|23490197]
  • defective in [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-mediated maturation of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • The protein

    Catalyzed reaction/ biological activity

  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex acts as specificity factor for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent processing of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex stimulates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation in the [category|SW 4.2.2|phosphorelay] [pubmed|27501195]
  • [SW|Domains]

  • PSP1 C-terminal domain (aa 61-146) (according to UniProt)
  • [SW|Cofactors]

  • two 4Fe-4S clusters (fully co-ordinates one cluster and contributes to the co-ordination of the second (with [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA] and [protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF])) [pubmed|31530674,28295778]
  • [SW|Localization]

  • cytoplasm [pubmed|27501195]
  • cell periphery, depending on [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    genes
    [gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • 600,000/ 11,500 molecules per cell during growth in LB/ minimal medium [pubmed|31530674]
  • Biological materials

    Mutant

  • MGNA-B899 (ricT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1898 NBRP B. subtilis, Japan]
  • BKE00320 (Δ[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00320 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_GACACCAATTACATTGTACA, downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
  • BKK00320 (Δ[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACACCAATTACATTGTACA, downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
  • References

    Reviews

  • 32061882,32156829,32156813
  • Original publications

  • 12270811,23490197,22383849,26434553,28295778,27501195,29794222,31530674