SubtiBank SubtiBank
yaaT
The papers of the month are back! Check them out! Link here

yaaT

subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex, required for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] dependent maturation of polycistronic mRNAs, control of the [SW|phosphorelay], required for the achieving a sufficient level of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P for [SW|sporulation] initiation
locus
BSU00320
pI
4.84
mw
31.07 kDa
protein length
275 aa Sequence Blast
gene length
825 bp Sequence Blast
function
control of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] activity, see [SW|Targets of the Y complex]
product
subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex
essential
no
synonyms
ricT

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.6|Other protein controlling the activity of the phosphorelay]
  • Gene

    Coordinates
    41,657 → 42,484

    Phenotypes of a mutant

  • block of [SW|sporulation] at stage 0 [Pubmed|12270811]
  • strongly reduced [SW|genetic competence], strongly reduced [SW|sporulation] [Pubmed|23490197]
  • defective in [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-mediated maturation of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • The protein

    Catalyzed reaction/ biological activity

  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex acts as specificity factor for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent processing of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex stimulates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation in the [category|SW 4.2.2|phosphorelay] [pubmed|27501195]
  • [SW|Cofactors]

  • two 4Fe-4S clusters [pubmed|28295778]
  • [SW|Localization]

  • cytoplasm [pubmed|27501195]
  • cell periphery, depending on [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|yabB]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|yabB]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    genes
    [gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|yabB]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B899 (ricT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1898 NBRP B. subtilis, Japan]
  • BKE00320 (Δ[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00320 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_GACACCAATTACATTGTACA, downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
  • BKK00320 (Δ[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACACCAATTACATTGTACA, downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
  • References

  • 12270811,23490197,22383849,26434553,28295778,27501195,29794222