SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


promoter of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair center assembly
42.15 kDa
protein length
370 aa Sequence Blast
gene length
1113 bp Sequence Blast
[category|SW 3.1.5|DNA repair/ recombination]
promoter of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair center assembly

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    3,437 → 4,549

    Phenotypes of a mutant

  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • The protein

    Catalyzed reaction/ biological activity

  • increases the efficiency of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair center assembly [Pubmed|24891441]
  • Protein family

  • RecF family (single member, according to UniProt)
  • Structure

  • [PDB|5Z67] (from Thermoanaerobacter tengcongensis, 33% identity) [pubmed|29391496]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE00040 (Δ[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATATACAATCAGTGTCACC, downstream forward: _UP4_AAGTGAAGAAATGAGGTGAG
  • BKK00040 (Δ[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATATACAATCAGTGTCACC, downstream forward: _UP4_AAGTGAAGAAATGAGGTGAG
  • References


  • 22933559,32286623
  • Original publications

  • 2987848,15186413,9207023,24285298,24891441,1716726,1909186,8510642,29391496