SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cystine and diaminopimelate transporter
48.82 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
cystine and diaminopimelate uptake
cystine and diaminopimelate transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Dicarboxylate/amino acid:cation symporter]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    986,986 → 988,377

    The protein

    Catalyzed reaction/ biological activity

  • cystine-proton symporter [Pubmed|15262924]
  • transport of diaminopimelate [pubmed|29995990]
  • Protein family

  • [SW|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
  • Kinetic information

  • K(m) = 0.6 myM cystine [Pubmed|15262924]
  • Structure

  • [PDB|3KBC] (from ''Pyrococcus horikoshii'', 28% identity) [Pubmed|19924125]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of sulfate or cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials


  • MGNA-A657 (yhcL::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A949 ( ''tcyP''::''spec''), [Pubmed|15262924], available at [ BGSC]
  • BKE09130 (Δ[gene|EC287BBD7AB1EB44A33BF29144448F53D06AC6D9|tcyP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAGGTAAACTCTCCC, downstream forward: _UP4_TAACATATGAAAACGTGTAA
  • BKK09130 (Δ[gene|EC287BBD7AB1EB44A33BF29144448F53D06AC6D9|tcyP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAGGTAAACTCTCCC, downstream forward: _UP4_TAACATATGAAAACGTGTAA
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 15262924,12193636,16513748,16513748,18763711,19924125,29995990