SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


nitrogen-regulated PII protein
12.68 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast
regulation of ammonium uptake
nitrogen-regulated PII protein

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,758,016 → 3,758,366

    The protein

    Protein family

  • P(II) protein family (single member, according to UniProt)
  • Structure

  • [PDB|4R25] [Pubmed|25691471]
  • [ 4R25] [Pubmed|25691471]
  • [ 2NUU] (the complex with [protein|796BD46066B1E6147048664FA78679B42FA9D628|NrgA], from ''E. coli'') [Pubmed|17220269]
  • [SW|Localization]

  • cell membrane, via [protein|796BD46066B1E6147048664FA78679B42FA9D628|NrgA] [Pubmed|14600241]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8282685], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced by ammonium limitation
  • view in new tab

    Biological materials


  • GP259 (ΔnrgB::cat), available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • GP255 (''Δ[gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]-[gene|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|nrgB]''::cat), available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • BKE36520 (Δ[gene|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|nrgB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGACCGCTCATAGCGTCAC, downstream forward: _UP4_TAATATCGGTACGAGATTCG
  • BKK36520 (Δ[gene|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|nrgB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGACCGCTCATAGCGTCAC, downstream forward: _UP4_TAATATCGGTACGAGATTCG
  • Expression vector

  • pGP182, Expression of His6-[protein|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|NrgB] from E. coli, available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • Antibody

  • available in [SW|Jörg Stülke]s lab [Pubmed|14600241]
  • labs

  • [SW|Susan Fisher], Boston, USA [ homepage]
  • References


  • 10637624,18182294,11238986,23847201
  • Original publications

  • 23010999,12823818,8799114,17001076,14600241,8282685,1670935,17220269,23535029,23818625,21435182,25691471,25755103