SubtiBank SubtiBank
nasC

nasC

nitrate reductase (catalytic subunit)
locus
BSU_03310
pI
6.73
mw
78.39 kDa
protein length
710 aa Sequence Blast
gene length
2133 bp Sequence Blast
function
utilization of nitrate
product
nitrate reductase (catalytic subunit)
essential
no
synonyms
narB,nasBB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.1|Utilization of nitrate/ nitrite]
  • Gene

    Coordinates
    358,303 → 360,435

    The protein

    Protein family

  • [SW|prokaryotic molybdopterin-containing oxidoreductase family] (according to UniProt)
  • [SW|Domains]

  • [SW|4Fe-4S Mo/W bis-MGD-type domain] (aa 19-77) (according to UniProt)
  • [SW|Cofactors]

  • MoCo [Pubmed|11289299]
  • Fe-S cluster [Pubmed|11289299]
  • Structure

  • [PDB|2IV2] (from E. coli, 32% identity) [pubmed|16830149]
  • Expression and Regulation

    Operons

    genes
    [gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
    description
    [Pubmed|7836289]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials

    Mutant

  • BKE03310 (Δ[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCAGTCGTTCAGTCAAAA, downstream forward: _UP4_TAAATTTTTCATAAAATTTT
  • BKK03310 (Δ[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCAGTCGTTCAGTCAAAA, downstream forward: _UP4_TAAATTTTTCATAAAATTTT
  • References

    Reviews

  • 22103536,11289299
  • Original publications

  • 12823818,7868621,25755103,8799114,16885456,16830149