SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


nitrate reductase (catalytic subunit)
78.39 kDa
protein length
710 aa Sequence Blast
gene length
2133 bp Sequence Blast
utilization of nitrate
nitrate reductase (catalytic subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of nitrate/ nitrite]
  • Gene

    358,303 → 360,435

    The protein

    Protein family

  • [SW|prokaryotic molybdopterin-containing oxidoreductase family] (according to UniProt)
  • [SW|Domains]

  • [SW|4Fe-4S Mo/W bis-MGD-type domain] (aa 19-77) (according to UniProt)
  • [SW|Cofactors]

  • MoCo [Pubmed|11289299]
  • Fe-S cluster [Pubmed|11289299]
  • Structure

  • [PDB|2IV2] (from E. coli, 32% identity) [pubmed|16830149]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials


  • BKE03310 (Δ[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCAGTCGTTCAGTCAAAA, downstream forward: _UP4_TAAATTTTTCATAAAATTTT
  • BKK03310 (Δ[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCAGTCGTTCAGTCAAAA, downstream forward: _UP4_TAAATTTTTCATAAAATTTT
  • References


  • 22103536,11289299
  • Original publications

  • 12823818,7868621,25755103,8799114,16885456,16830149