SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


20.97 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    3,755,291 → 3,755,860

    The protein

    Protein family

  • [SW|Isochorismatase family] (according to UniProt)
  • Structure

  • [PDB|1J2R] (from E. coli, 46% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21856850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA]: repression, [Pubmed|21856850], in [regulon|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA regulon]
  • regulation

  • induced by ramoplanin ([protein|search|YtrA]) [Pubmed|21856850]
  • view in new tab

    Biological materials


  • MGNA-A932 (ywoC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36490 (Δ[gene|ECBA7A0C8E705A464ACF627EBAFF7482EAEE34F2|ywoC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGTCTCCTCCTGATAC, downstream forward: _UP4_GAGTTTCTGGAACAAGTGAA
  • BKK36490 (Δ[gene|ECBA7A0C8E705A464ACF627EBAFF7482EAEE34F2|ywoC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGTCTCCTCCTGATAC, downstream forward: _UP4_GAGTTTCTGGAACAAGTGAA