SubtiBank SubtiBank
glpT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glpT

glycerol-3-phosphate permease
locus
BSU_02140
pI
9.37
mw
49.64 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast
function
glycerol-3-phosphate uptake
product
glycerol-3-phosphate permease
essential
no
synonyms
ybeE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.3|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.1|Utilization of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    233,994 → 235,328

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Structure

  • [PDB|1PW4] (from E. coli, 60% identity) [pubmed|12893936]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]-[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]
    description
    [Pubmed|8012593]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8012593], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, via a protein-dependent [SW|RNA switch] [Pubmed|8012593], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10913081], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
  • view in new tab

    Biological materials

    Mutant

  • QB5437 (ermC), available in the [SW|Stülke] lab
  • BKE02140 (Δ[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATAATTATCCCCCTT, downstream forward: _UP4_TAAGAAAGACACATAAAAGA
  • BKK02140 (Δ[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATAATTATCCCCCTT, downstream forward: _UP4_TAAGAAAGACACATAAAAGA
  • References

  • 8012593,12850135,12893936