SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phosphoglycerate kinase, glycolytic/ gluconeogenic enzyme, universally conserved protein
42.03 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
enzyme in glycolysis/ gluconeogenesis
phosphoglycerate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW|Substrate-level phosphorylation]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Gluconeogenesis]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]
  • Gene

    3,480,197 → 3,481,381

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
  • suppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • 3-phospho-D-glycerate + ATP --> 3-phospho-D-glyceroyl phosphate + ADP (according to UniProt)
  • Protein family

  • phosphoglycerate kinase family (single member, according to UniProt)
  • Kinetic information

  • Two Substrate Reversible Michaelis-Menten [Pubmed|7154941]
  • [SW|Domains]

  • nucleotide binding domain (ATP) (350–353)
  • 2x substrate binding domain (21–23), (59–62)
  • Modification

  • phosphorylation on Ser-183 AND Thr-299 [Pubmed|17218307], [Pubmed|17726680]
  • [SW|Cofactors]

  • Mg2 or Mn2 [Pubmed|7154941]
  • Effectors of protein activity

  • Inhibited by Co2 , NDP and NMP [Pubmed|7154941]
  • Structure

  • [PDB|1PHP] (from ''Geobacillus stearothermophilus'')
  • Additional information

  • extensive information on the structure and enzymatic properties of Pgk can be found at [ Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [Pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] [Pubmed|11489127]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    view in new tab

    Biological materials


  • GP699 (''pgk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]lab
  • GP707 (''pgk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • BKK33930 (Δ[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTAGGAGATCCTCCT, downstream forward: _UP4_TAATCTCAAAACTGCTATAA
  • Expression vectors

  • pGP1102 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP95 (N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP91 (N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • pGP1513 (expression in ''B. subtilis'', in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP514 (in [SW|pAC6]), a series of promoter deletion variants is also available in [SW|pAC6], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available iin [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • References

  • 16479537,12850135,17726680,11489127,17505547,17218307,7154941,12682299,23420519,15378759,24825009,28189581