SubtiBank SubtiBank
pgk
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pgk

phosphoglycerate kinase, glycolytic/ gluconeogenic enzyme, universally conserved protein
locus
BSU_33930
pI
4.77
mw
42.03 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
function
enzyme in glycolysis/ gluconeogenesis
product
phosphoglycerate kinase
essential
No
ec
2.7.2.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.2|Substrate-level phosphorylation]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]
  • Gene

    Coordinates
    3,480,197 → 3,481,381

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
  • suppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • 3-phospho-D-glycerate + ATP --> 3-phospho-D-glyceroyl phosphate + ADP (according to UniProt)
  • Protein family

  • phosphoglycerate kinase family (single member, according to UniProt)
  • Kinetic information

  • Two Substrate Reversible Michaelis-Menten [Pubmed|7154941]
  • [SW|Domains]

  • nucleotide binding domain (ATP) (350–353)
  • 2x substrate binding domain (21–23), (59–62)
  • Modification

  • phosphorylation on Ser-183 AND Thr-299 [Pubmed|17218307], [Pubmed|17726680]
  • [SW|Cofactors]

  • Mg2 or Mn2 [Pubmed|7154941]
  • Effectors of protein activity

  • Inhibited by Co2 , NDP and NMP [Pubmed|7154941]
  • Structure

  • [PDB|1PHP] (from ''Geobacillus stearothermophilus'')
  • Additional information

  • extensive information on the structure and enzymatic properties of Pgk can be found at [http://www.proteopedia.org/wiki/index.php/Phosphoglycerate_Kinase Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]-[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
    description
    [Pubmed|11489127]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [Pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] [Pubmed|11489127]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    genes
    [gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
    description
    [Pubmed|11489127]
    view in new tab

    Biological materials

    Mutant

  • GP699 (''pgk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]lab
  • GP707 (''pgk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • BKK33930 (Δ[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTAGGAGATCCTCCT, downstream forward: _UP4_TAATCTCAAAACTGCTATAA
  • Expression vectors

  • pGP1102 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP95 (N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP91 (N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • pGP1513 (expression in ''B. subtilis'', in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP514 (in [SW|pAC6]), a series of promoter deletion variants is also available in [SW|pAC6], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available iin [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • References

  • 16479537,12850135,17726680,11489127,17505547,17218307,7154941,12682299,23420519,15378759,24825009,28189581