SubtiBank SubtiBank
yfhM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfhM

general stress protein, epoxide hydrolase
locus
BSU_08590
pI
6.06
mw
32.61 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
function
survival of ethanol stress
product
epoxide hydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    929,725 → 930,585

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 27-272) (according to UniProt)
  • Structure

  • [PDB|4NZZ] (from ''Bacillus Megaterium'', 33% identity)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|893103B8E6163A4B403CA136A92BA3EA66DC3802|yfhK]-[gene|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL]-[gene|ED478E2C37F2AD8BF06251B52511287EDB91C9EE|yfhM]
    description
    [Pubmed|10913081]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10913081,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|10913081,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C318 (yfhM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2316 NBRP B. subtilis, Japan]
  • BKE08590 (Δ[gene|ED478E2C37F2AD8BF06251B52511287EDB91C9EE|yfhM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGTTCGTATTGACAAACT, downstream forward: _UP4_TAAGCTAAAATTTCTCTCCA
  • BKK08590 (Δ[gene|ED478E2C37F2AD8BF06251B52511287EDB91C9EE|yfhM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGTTCGTATTGACAAACT, downstream forward: _UP4_TAAGCTAAAATTTCTCTCCA
  • References

  • 9987136,10913081,15805528,31457061