SubtiBank SubtiBank
gerKA [2020-04-07 17:53:58]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gerKA [2020-04-07 17:53:58]

nutrient receptor
60.22 kDa
protein length
544 aa Sequence Blast
gene length
1635 bp Sequence Blast
germination response to the combination of glucose, fructose, aspartate, and KCl
nutrient receptor

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    420,110 → 421,744

    The protein

    Protein family

  • [SW|GerABKA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|GerAA], [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD], [protein|3368743E6E03792DB83A38A19989123304DF7560|GerBA], [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ]
  • [SW|Domains]

  • contains multiple membrane-spanning domains [Pubmed|23335419]
  • Structure

  • [PDB|6O59] (from B. megaterium, corresponds to aa 40 ... 299, 53.6% identity)
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419,21696470]
  • Additional information

  • 700 molecules are present per spore [Pubmed|23749970]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16707705], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16707705], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16707705]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials


  • BKE03700 (Δ[gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACAAATACCTTTCCT, downstream forward: _UP4_AAAGATTTGGAAGAAGGGGA
  • BKK03700 (Δ[gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACAAATACCTTTCCT, downstream forward: _UP4_AAAGATTTGGAAGAAGGGGA
  • References

  • 16707705,16352818,21696470,23335419,23396907,22343299,16740944,23749970,24752279,26731423