SubtiBank SubtiBank
yhbI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhbI

similar to transcriptional regulator ([SW|MarR family])
locus
BSU_08990
pI
8.69
mw
17.46 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    976,569 → 977,033

    The protein

    Protein family

  • [SW|MarR family]
  • Structure

  • [PDB|1S3J] ([protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|MdtR], corresponds to aa 38 - 139 of YhbI, 27% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]-[gene|211C58A92BA2A06A34B1F73BDB68A0F581B942C2|yhbJ]-[gene|93159DC7D5C42CFA54F66F232D73F38957243AB7|yhcA]-[gene|7797B0B66922D51B9D142DD2E5857836E47F015B|yhcB]-[gene|95EED3A91483502CA78067421F678B1EDB965B18|yhcC]
    description
    [Pubmed|22383849]

    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 4 to 41 min) [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B469 (yhbI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1468 NBRP B. subtilis, Japan]
  • BKE08990 (Δ[gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCCTTTTCACCTCATT, downstream forward: _UP4_TAAAAACTTCTCACATATTT
  • BKK08990 (Δ[gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCCTTTTCACCTCATT, downstream forward: _UP4_TAAAAACTTCTCACATATTT
  • References

  • 21815947