SubtiBank SubtiBank
xis
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

xis

excisionase
locus
BSU_04830
pI
9.64
mw
7.17 kDa
protein length
gene length
195 bp Sequence Blast
function
excision of the conjugative transposon ICEBs1 from the trnS-leu2 locus
product
excisionase
essential
no
synonyms
ydzC, sacV

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    Coordinates
    531,787 → 531,981

    The protein

    Catalyzed reaction/ biological activity

  • excision of conjugative transposon [Pubmed|18005101]
  • Additional information

  • Was reported to be involved in the regulation of the levansucrase gene (''[gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]'')
  • Expression and Regulation

    Operons

    genes
    [gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]-[gene|2227923C603B290AB276238F789D71584FB07DF3|ydzL]-[gene|34451538F10B4ABCFC8A236C8C905A20D989EBCF|ydcO]-[gene|C042792D9A643DCFF4A851EFECA3CF2C31E1EDAF|ydcP]-[gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]-[gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]-[gene|886B2132717BA4C72433ABE351C5791C9DE1432A|S172]-[gene|1699CFBF5400CAF43C6DAE8ADCCE5A360B31F2E9|ydcS]-[gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]-[gene|62CEABA069CA2970F22B7E0C369D540A2A027A8D|yddA]-[gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]-[gene|F273A8817E66B44D58FC2BCB6576A30D8616B750|conC]-[gene|F1F898D7A9FDF78D2E5E8F3BF605E0F735D0542A|conD]-[gene|D20F724D8C3E8C758A9FADF133CD43F066BD8D48|conE]-[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]-[gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]-[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]-[gene|2E4FF80C857B3F40BA835814EC40D6562721AEFE|yddI]-[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE04830 (Δ[gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATATCACCTCCTCGTT, downstream forward: _UP4_AAAGGCCCAAAATCTCAAAC
  • BKK04830 (Δ[gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATATCACCTCCTCGTT, downstream forward: _UP4_AAAGGCCCAAAATCTCAAAC
  • References

  • 18005101,17511812