SubtiBank SubtiBank
mtlF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtlF

mannitol-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIA of the [category|SW 1.2.2|PTS]
locus
BSU_03982
pI
4.50
mw
16.00 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
mannitol uptake and phosphorylation
product
mannitol-specific [category|SW 1.2.2|PTS], EIIA
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.10|Utilization of mannitol]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    451,185 → 451,616

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, fructose/ mannitol family [Pubmed|10627040]
  • Structure

  • [PDB|1A3A] (from E. coli, 41% identity) [pubmed|9551558]
  • Expression and Regulation

    Operons

    genes
    [gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]
    description
    [Pubmed|12897001]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22014119], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]: activation, [Pubmed|20444094], in [regulon|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR regulon]
  • regulation

  • induced by mannitol ([protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR]) [Pubmed|20444094]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE03982 (Δ[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03982 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAATCACTCTCTTTC, downstream forward: _UP4_GCCATTTTCAACGAGGTGAA
  • BKK03982 (Δ[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03982 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAATCACTCTCTTTC, downstream forward: _UP4_GCCATTTTCAACGAGGTGAA
  • References

  • 12897001,20444094,9551558