SubtiBank SubtiBank
ymcA [2018-05-30 18:21:47]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ymcA [2018-05-30 18:21:47]

subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex, required for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] dependent maturation of polycistronic mRNAs, antagonist of biofilm repression by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR], control of the [SW|phosphorelay]
16.02 kDa
protein length
143 aa Sequence Blast
gene length
429 bp Sequence Blast
control of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] activity
subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW|Effectors of RNA degradation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • Gene

    1,774,374 → 1,774,805

    Phenotypes of a mutant

  • strongly reduced [SW|genetic competence], strongly reduced [SW|sporulation] [Pubmed|23490197]
  • defective in [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-mediated maturation of polycistronic mRNAs [pubmed|29794222]
  • The protein

    Catalyzed reaction/ biological activity

  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex acts as specificity factor for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent processing of polycistronic mRNAs [pubmed|29794222]
  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex stimulates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation in the [category|SW 4.2.2|phosphorelay] [pubmed|27501195]
  • Structure

  • [PDB|2PIH]
  • [SW|Localization]

  • cytoplasm [pubmed|27501195]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE17020 (Δ[gene|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_GTCTTTTTTTGAGTAGAGCG, downstream forward: _UP4_TAAACACGGTGCCTTTACAG
  • BKK17020 (Δ[gene|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTTTTTTTGAGTAGAGCG, downstream forward: _UP4_TAAACACGGTGCCTTTACAG
  • References

  • 15661000,23490197,15175311,26434553,28295778,27501195,29794222